NEET · Biology · STD 12 - 2. human reproduction
Receptors for sperm binding in mammals are present on :
- A Corona radiata
- B Vitelline membrane
- C Perivitelline space
- D Zona pellucida
Answer & Solution
Correct Answer
(D) Zona pellucida
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- At which stage of life the oogenesis process is initiated?NEET 2022 Easy
- What is the probability of having children with 'O' blood group, where both mother and father are heterozygous for 'A' and 'B' blood group, respectively ?NEET 2026 Hard
- A phosphoglyceride is always made up ofNEET 2013 Medium
- Match List I with List II :
Choose the correct answer from the options given below :List I (Drug) List II (Effect) A. Nicotine I. Causes sense of euphoria and increased energy B. Morphine II. Stimulates adrenal gland to release catecholamines into blood circulation C. Heroin III. Effective sedative and painkiller D. Cocaine IV. A depressant; slows down body function NEET 2026 Medium - Select the correct sequence of eventsNEET 2019 Hard
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
More PYQs from NEET
- Which one of the following statements is not true?NEET 2016 Medium
- Water falls from a height of \(60\, \mathrm{~m}\) at the rate of \(15 \,\mathrm{~kg} / \mathrm{s}\) to operate a turbine. The losses due to frictional force are \(10\, \%\) of the input energy. How much 10.Power is generated by the turbine? \(\left(g=10\, \mathrm{~m} / \mathrm{s}^{2}\right)\) (In \(\mathrm{~kW}\))NEET 2021 Medium
- The value of Planck's constant is \(6.63 \times 10^{-34} \ J \ s.\) The speed of light is \(3 \times 10^{17}\, nm\, s ^{-1}.\) Which value is closest to the wavelength in nanometer of a quantum of light with frequency of \(6 \times 10^{18} s^{-1} \) ?NEET 2013 Hard
- Given below are two statements:
Statement \(I\): Chromosomes become gradually visible under light microscope during leptotene stage.
Statement \(II\) : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:NEET 2024 Medium - Consider the reaction, \(CH_3CH_2CH_2Br + NaCN \to \)\(CH_3CH_2CH_2CN+ NaBr\) This reaction will be the fastest inNEET 2016 Hard
- Assertion \((A):\) A person goes to high altitude and experiences 'altitude sickness' with symptoms like breathing difficulty and heart palpitations. Reason \((R):\) Due to low atmospheric pressure at high altitude, the body does not get sufficient oxygen. In the light of the above statements, choose the correct answer from the options given below.NEET 2021 Medium