NEET · Biology · STD 12 - 5. molecular basis of inheritance
Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)
- A \(5'AUGUAAAGUUUAUAGGUAAGU3'\)
- B \(5'AUGUACCGUUUAUAGGGAAGU3'\)
- C \(5'ATGTACCGTTTATAGGTAAGT3'\)
- D \(5'AUGUACCGUUUAUAGGUAAGU3'\)
Answer & Solution
Correct Answer
(D) \(5'AUGUACCGUUUAUAGGUAAGU3'\)
Step-by-step Solution
Detailed explanation
Template \(DNA\) is : \(3'TACATGGCAAATATCCATTCA 5'\)
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Given below are two statements:
Statement \(I\) : During G0 phase of cell cycle, the cell is metabolically inactive.
Statement \(II\) : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:NEET 2023 Medium - A specialised membranous structure in a prokaryotic cell which helps in cell wall formation, DNA replication and respiration is _______.NEET 2025 Easy
- Industrial melanism is an example ofNEET 2015 Hard
- Select the correct statements regarding cell membrane in eukaryotic cell.
A. Membrane of human RBCs has approximately 52% protein.
B. Major phospholipids are arranged in a bilayer.
C. Extensions of the plasma membrane into the cell form mesosomes.
D. Tails towards the inner part of lipids are hydrophobic and thus protected from aqueous medium.
E. Glycocalyx is present on the outer surface of the plasma membrane.
Choose the correct answer from the options given below :NEET 2026 Hard - The structures that are formed by stacking of organised flattened membranous sacs in the chloroplasts areNEET 2015 Medium
- Match List \(I\) with List \(II\)
Choose the correct answer from the options given below:List \(I\) List \(II\) \(A\)Citric acid cycle \(I\) Cytoplasm \(B\) Glycolysis \(II\) Mitochondrial matrix \(C\) Electron transport system \(III\) Intermembrane space of mitochondria \(D\) Proton gradient \(IV\) Inner mitochondrial membrane NEET 2024 Medium
More PYQs from NEET
- Identify the hormone with its correct matching of source and function.NEET 2014 Medium
- A mixture of gases contains \(H_2\) and \(O_2\) gases in the ratio of \(1 : 4\ (w/w).\) What is the molar ratio of the two gases in the mixture?NEET 2015 Hard
- For effective treatment of the disease, early diagnosis and understanding its pathophysiology is very important. Which of the following molecular diagnostic techniques is very useful for early detection?NEET 2021 Medium
- Select the correct matching in the following pairs.NEET 2015 Medium
- Imagine earth to be a solid sphece of mass \(M\) and radius \(R\). If the value of acceleration due to gravity at a depth d below earth's surface is same as its value at a height \(h\) above its surface and equal to \(\frac{g}{4}\) (where \(g\) is the value of acceleration due to gravity on the surface of earth), the ratio of \(\frac{h}{d}\) will beNEET 2017 Medium
- Match the hominids with their correct brain size
Select the correct option. \((a)\quad (b)\quad (c)\quad (d)\)\((a)\) Homo habilis \((i)\) \(900\; \mathrm{cc}\) \((b)\) Homo neanderthalensis \((ii)\) \(1350\; \mathrm{cc}\) \((c)\) Homo erectus \((iii)\) \(650-800\; \mathrm{cc}\) \((d)\) Homo sapiens \((iv)\) \(1400\; \mathrm{cc}\) NEET 2019 Easy