NEET · Physics · STD 12 - 3. current electricity
Three resistors having resistances \(\mathrm{r}_{1}, \mathrm{r}_{2}\) and \(\mathrm{r}_{3}\) are connected as shown in the given circuit. The ratio \(\frac{i_{3}}{i_{1}}\) of currents in terms of resistances used in the circuit is :

- A \(\frac{r_{1}}{r_{2}+r_{3}}\)
- B \(\frac{r_{2}}{r_{2}+r_{3}}\)
- C \(\frac{r_{1}}{r_{1}+r_{2}}\)
- D \(\frac{r_{2}}{r_{1}+r_{3}}\)
Answer & Solution
Correct Answer
(B) \(\frac{r_{2}}{r_{2}+r_{3}}\)
Step-by-step Solution
Detailed explanation
\(I_{3}=\frac{I_{1} r_{2}}{r_{2}+r_{3}}\) \(\frac{I_{3}}{I_{1}}=\frac{I_{1} r_{2}}{\left(r_{2}+r_{3}\right) I_{1}}=\frac{r_{2}}{r_{2}+r_{3}}\)
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Physics
- The kinetic energies of two similar cars \(A\) and \(B\) are 100 J and 225 J respectively. On applying breaks, car A stops after 1000 m and car B stops after 1500 m . If \(F _{ A }\) and \(F _{ B }\) are the forces applied by the breaks on cars A and B , respectively, then the ratio \(F _{ A } / F _{ B }\) is :NEET 2025 Easy
- A ball of mass \(1 \;kg\) is thrown vertically upwards and returns to the ground after \(3\; seconds\). Another ball, thrown at \(60^{\circ}\) with vertical also stays in air for the same time before it touches the ground. The ratio of the two heights areNEET 2017 Medium
- Two toroids \(1\) and \(2\) have total number of tums \(200\) and \(100 \) respectively with average radii \(40\; \mathrm{cm}\) and \(20 \;\mathrm{cm}\) respectively. If they carry same current \(i,\) the ratio of the magnetic flelds along the two loops isNEET 2019 Medium
- Two point charges \(A\) and \(B\), having charges \(+Q\) and \(- Q\) respectively, are placed at certain distance apart and force acting between them is \(\mathrm{F}\). If \(25 \%\) charge of \(A\) is transferred to \(B\), then force between the charges becomesNEET 2019 Medium
- A rigid ball of mass \(m\) strikes a rigid wall at \(60^o \) and gets reflected without loss of speed as shown in the figure. The value of impulse imparted by the wall on the ball will be
NEET 2016 Medium - Two cylinders \(A\) and \(B\) of equal capacity are connected to each other via a stop cock. A contains an Ideal gas at standard temperature and pressure. \(B\) is completely evacuated. The entire system is thermally insulated. The stop cock is suddenly opened. The process is :NEET 2020 Easy
More PYQs from NEET
- The species confined to a particular region and not found elsewhere is termed asNEET 2015 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Which one of the following statements is not true?NEET 2016 Medium
- The genotypes of a husband and wife are \(I^AI^B\) and \(I^Ai\). Among the blood types of their children, how many different genotypes and phenotypes are possible?NEET 2017 Medium
- In Young's double slit experiment, using monochromatic light of wavelength \(\lambda\), the intensity of light at a point on the screen where the path difference is \(\lambda\), is K units. The intensity of light at a point where the path difference is \(\frac{\lambda}{3}\) will be :NEET 2026 Hard
- The angular speed of the wheel of a vehicle is increased from \(360 \;rpm\) to \(1200 \;rpm\) in \(14 \;second\). Its angular acceleration is,NEET 2020 Medium