NEET · Chemistry · STD 11 - 8.2 Organic chemistry isomerism
The pair of molecules that are metamers among the following is :
- A \(CH _3 CH _2 CH _2 OH\) and \(CH _3- CH ( OH )- CH _3\)
- B \(CH _3 CH _2 CH _2 CH _2 CH _3\) and \(\left( CH _3\right)_2 CHCH _2 CH _3\)
- C \(H _3 C - CO - CH _3\) and \(H _3 C - CH _2- CHO\)
- D \(CH _3 OCH _2 CH _2 CH _3\) and \(CH _3 CH _2 OCH _2 CH _3\)
Answer & Solution
Correct Answer
(D) \(CH _3 OCH _2 CH _2 CH _3\) and \(CH _3 CH _2 OCH _2 CH _3\)
Step-by-step Solution
Detailed explanation
(D) \(CH _3 OCH _2 CH _2 CH _3\) and \(CH _3 CH _2 OCH _2 CH _3\)
Metamerism is a type of structural isomerism where isomers have the same molecular formula but differ in the nature of the alkyl groups attached to the same polyvalent functional group (such as \(- O -,- S -,- NH -,- CO -\) ).
In option (1), \(CH _3 CH _2 CH _2 OH\) and \(CH _3- CH ( OH )- CH _3\) are position isomers because the position of the - OH group differs.
In option (2), \(CH _3 CH _2 CH _2 CH _2 CH _3\) and \(\left( CH _3\right)_2 CHCH _2 CH _3\) are chain isomers because the carbon skeleton differs.
In option (3), \(H _3 C - CO - CH _3\) and \(H _3 C - CH _2- CHO\) are functional isomers because they have different functional groups (ketone and aldehyde).
In option (4), \(CH _3 OCH _2 CH _2 CH _3\) (methoxypropane) and \(CH _3 CH _2 OCH _2 CH _3\) (ethoxyethane) have the same polyvalent functional group ( \(- O -\) ) but different alkyl groups attached to it (methyl and propyl versus two ethyl groups). Thus, they are metamers.
Metamerism is a type of structural isomerism where isomers have the same molecular formula but differ in the nature of the alkyl groups attached to the same polyvalent functional group (such as \(- O -,- S -,- NH -,- CO -\) ).
In option (1), \(CH _3 CH _2 CH _2 OH\) and \(CH _3- CH ( OH )- CH _3\) are position isomers because the position of the - OH group differs.
In option (2), \(CH _3 CH _2 CH _2 CH _2 CH _3\) and \(\left( CH _3\right)_2 CHCH _2 CH _3\) are chain isomers because the carbon skeleton differs.
In option (3), \(H _3 C - CO - CH _3\) and \(H _3 C - CH _2- CHO\) are functional isomers because they have different functional groups (ketone and aldehyde).
In option (4), \(CH _3 OCH _2 CH _2 CH _3\) (methoxypropane) and \(CH _3 CH _2 OCH _2 CH _3\) (ethoxyethane) have the same polyvalent functional group ( \(- O -\) ) but different alkyl groups attached to it (methyl and propyl versus two ethyl groups). Thus, they are metamers.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Chemistry
- Which of the following molecules has the maximum dipole moment ?NEET 2014 Medium
- The reason for greater range of oxidation states in actinoids is attributed toNEET 2017 Medium
- Reason of lanthanoid contraction isNEET 2014 Easy
- Iron carbonyl, \(Fe(CO)_5\) isNEET 2018 Medium
- Match List\(-I\) with List\(-II\).
Choose the correct answer from the options given below.List\(-II\) List\(-II\) \((a)\) \({PCl}_{5}\) \((i)\) Square pyramidal \((b)\) \({SF}_{6}\) \((ii)\) Trigonal planar \((c)\) \({BrF}_{5}\) \((iii)\) Octahedral \((d)\) \({BF}_{3}\) \((iv)\) Trigonal bipyramidal NEET 2021 Easy - The energy of an electron in the ground state \((n=1)\) for \(\mathrm{He}^{+}\)ion is \(-x ~J\), then that for an electron in \(n=2\) state for \(Be^{3+}\) ion in \(J\) isNEET 2024 Medium
More PYQs from NEET
- Which of the following statements is incorrect about gymnosperms?NEET 2020 Easy
- A small hole of area of cross-section \(2\; \mathrm{mm}^{2}\) is present near the bottom of a fully filled open tank of height \(2\; \mathrm{m} .\) Taking \(\mathrm{g}=10 \;\mathrm{m} / \mathrm{s}^{2},\) the rate of flow of water through the open hole would be nearly ......... \(\times 10^{-6} \;m^{3} /s\)NEET 2019 Medium
- In order to increase the yield of sugarcane crop, which of the following plant growth regulators should be sprayed?NEET 2019 Easy
- The average thermal energy for a mono\(-\)atomic gas is : \(\left( k _{ B }\right.\) is Boltzmann constant and \(T ,\) absolute \(e\). temperature)NEET 2020 Easy
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A) : All vertebrates are chordates but all chordates are not vertebrate.
Reason (R) : The members of subphylum vertebrata possess notochord during the embryonic period, the notochord is replaced by cartilaginous or bony vertebral column in adults.
In the light of the above statements, choose the correct answer from the options given below:NEET 2025 Easy