enEnglishguગુજરાતી
NEET · Chemistry · STD 12 - 5. Co-ordination chemistry
The manganate and permanganate ions are tetrahedral, due to
- A The \(\pi\) -bonding involves overlap of \(p-\)orbitals of oxygen with \(d-\)orbitals of manganese
- B There is no \(\pi\) -bonding
- C The \(\pi\) -bonding involves overlap of \(p-\)orbitals of oxygen with \(p-\)orbitals of managanese
- D The \(\pi\) -bonding involves overlap of \(d-\)orbitals of oxygen with \(d-\)orbitals of manganese
Answer & Solution
Correct Answer
(A) The \(\pi\) -bonding involves overlap of \(p-\)orbitals of oxygen with \(d-\)orbitals of manganese
Step-by-step Solution
Detailed explanation
\(\mathrm{MnO}_{4}^{-2}\) (Mangnate ion) and \(MnO^-\) (Permangnate ion) both are tetrahedral
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Chemistry
- The van't Hoff factor \((i)\) for a dilute aqueous solution of the strong electrolyte barium hydroxide isNEET 2016 Easy
- Of the following alcohols, the one that would react fastest with conc. \(HCl\) and anhydrous \(ZnCl_{2}\) is,NEET 2017 Medium
- In which of the following processes entropy increases? \(A\). A liquid evaporates to vapour. \(B\). Temperature of a crystalline solid lowered from \(130 \mathrm{~K}\) to \(0 \mathrm{~K}\). \(C\). \(2 \mathrm{NaHCO}_{3(\mathrm{~s})} \rightarrow \mathrm{Na}_2 \mathrm{CO}_{3(\mathrm{~s})}+\mathrm{CO}_{2(\mathrm{~g})}+\mathrm{H}_2 \mathrm{O}_{(\mathrm{g})}\) \(D\). \(\mathrm{Cl}_{2(g)} \rightarrow 2 \mathrm{Cl}_{(g)}\) Choose the correct answer from the options given below:NEET 2024 Medium
- How many products (including stereoisomers) are expected from monochlorination of the following compound?
NEET 2025 Hard - Suppose the elements \(X\) and \(Y\) combine to form two compounds \(XY_2\) and \(X_3Y_2.\) When \(0.1\) mole of \(XY_2\) weighs \(10\ g\) and \(0.05\) mole of \(X_3Y_2\) weighs \(9\ g,\) the atomic weights of \(X\) and \(Y\) areNEET 2016 Medium
- Given below are two statements : Statement \(I:\)
In Lucas test, primary, secondary and tertiary alcohols are distinguished on the basis of their reactivity with conc. \(HCl + ZnCl _{2}\), known as Lucas Reagent. Statement \(II :\)
Primary alcohols are most reactive and immediately produce turbidity at room temperature on reaction with Lucas Reagent. In the light of the above statements, choose the most appropriate answer from the options given below :NEET 2022 Medium
More PYQs from NEET
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- The figure shows a section of human ovary. Select the option which gives the correct identification of either \(A\) or \(B\) with function/ characteristic.
NEET 2013 Medium - The active form of Entamoeba histolytica feeds uponNEET 2015 Medium
- Which of the following joints would allow no movements?NEET 2015 Medium
- A straight conductor carrying current \(i\) splits into two parts as shown in the figure. The radius of the circular loop is \(R\). The total magnetic field at the centre \(P\) of the loop is
NEET 2019 Medium - Identify the correct description about the given figure:
NEET 2024 Medium