NEET · Chemistry · STD 12 - 9. Amines
The following two reactions give the same foul smelling product Z.

X and Z, respectively, are :
- A \(X= AgCN ; Z= C _2 H _5 NC\)
- B \(X= KCN ; Z= C _2 H _5 CN\)
- C \(X = AgCN ; Z= C _2 H _5 CN\)
- D \(X= KCN ; Z= C _2 H _5 NC\)
Answer & Solution
Correct Answer
(A) \(X= AgCN ; Z= C _2 H _5 NC\)
Step-by-step Solution
Detailed explanation
(A) \(X= AgCN ; Z= C _2 H _5 NC\)
In the second sequence of reactions, \(C _2 H _5 CONH _2\) undergoes Hoffmann bromamide degradation with \(Br _2\) and NaOH to form a primary amine with one less carbon atom. Thus, \(Y\) is ethylamine \(\left( C _2 H _5 NH _2\right)\).
Ethylamine \((Y)\) then reacts with \(CHCl _3\) and ethanolic KOH in a carbylamine reaction to form ethyl isocyanide ( \(C _2 H _5 NC\) ), which is known for its foul smell. Therefore, \(Z\) is \(C _2 H _5 NC\).
In the first reaction, ethyl chloride \(\left( C _2 H _5 Cl \right)\) reacts with a reagent \(X\) to give the same product \(Z\left( C _2 H _5 NC \right)\). To obtain an isocyanide as the major product from an alkyl halide, the reagent used is silver cyanide \(( AgCN )\), because AgCN is predominantly covalent and the nitrogen atom acts as the nucleophilic center.
Hence, \(X= AgCN\) and \(Z= C _2 H _5 NC\).
In the second sequence of reactions, \(C _2 H _5 CONH _2\) undergoes Hoffmann bromamide degradation with \(Br _2\) and NaOH to form a primary amine with one less carbon atom. Thus, \(Y\) is ethylamine \(\left( C _2 H _5 NH _2\right)\).
Ethylamine \((Y)\) then reacts with \(CHCl _3\) and ethanolic KOH in a carbylamine reaction to form ethyl isocyanide ( \(C _2 H _5 NC\) ), which is known for its foul smell. Therefore, \(Z\) is \(C _2 H _5 NC\).
In the first reaction, ethyl chloride \(\left( C _2 H _5 Cl \right)\) reacts with a reagent \(X\) to give the same product \(Z\left( C _2 H _5 NC \right)\). To obtain an isocyanide as the major product from an alkyl halide, the reagent used is silver cyanide \(( AgCN )\), because AgCN is predominantly covalent and the nitrogen atom acts as the nucleophilic center.
Hence, \(X= AgCN\) and \(Z= C _2 H _5 NC\).
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Chemistry
- The most stable carbocation, among the following isNEET 2019 Hard
- Given below are certain reactions. Identify the reaction for which \(K_p \neq K_c:\)NEET 2026 Easy
- Which will make basic buffer?NEET 2019 Hard
- Gadolinium belongs to \(4f\) series. Its atomic number is \(64.\) Which of the following is the correct electronic configuration of gadolinium?NEET 2015 Medium
- In a particular isomer of \([Co(NH_3)4Cl_2]^0,\) the \(Cl - Co - Cl\) angle is \(90^o ,\) the isomer is known asNEET 2013 Medium
- The number of angular nodes and radial nodes in \(3 s\) orbital areNEET 2020 Easy
More PYQs from NEET
- Which of the following statements is correct?NEET 2018 Medium
- Which one of the following organisms bears hollow and pneumatic long bones?NEET 2021 Hard
- Identify the incorrect statement related to Pollination:NEET 2022 Hard
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- Drug called Heroin' is synthesized byNEET 2019 Medium
- In a metre bridge experiment (see figure), the positions of the cell, \(E\), and galvanometer, \(G\), are interchanged. We shall observe in the galvanometer :
NEET 2026 Medium