NEET · Chemistry · STD 12 -1. Solution and colligative properties
Match List - I with List - II
| List-I (Example) | List-II(Type of Solution) |
| A. Humidity | I. Solid in solid |
| B. Alloys | II. Liquid in gas |
| C. Amalgams | III. Solid in gas |
| D. Smoke | IV. Liquid in solid |
- A A-II, B-IV, C-I, D-III
- B A-II, B-I, C-IV, D-III
- C A-III, B-I, C-IV, D-II
- D A-III, B-II, C-I, D-IV
Answer & Solution
Correct Answer
(B) A-II, B-I, C-IV, D-III
Step-by-step Solution
Detailed explanation
A \(\rightarrow\) Humidity \(\Rightarrow\) Liquid in Gas
B \(\rightarrow\) Alloy \(\Rightarrow\) Solid in solid
C \(\rightarrow\) Amalgams \(\Rightarrow\) Liquid in solid
D \(\rightarrow\) Smoke \(\Rightarrow\) Solid in Gas
B \(\rightarrow\) Alloy \(\Rightarrow\) Solid in solid
C \(\rightarrow\) Amalgams \(\Rightarrow\) Liquid in solid
D \(\rightarrow\) Smoke \(\Rightarrow\) Solid in Gas
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Chemistry
- Dipole-induced dipole interactions are present in which of the following pairsNEET 2013 Hard
- Given below are two statements: Statement \(I\) : The boiling point of three isomeric pentanes follows the order n-pentane \(>\) isopentane \(>\) neopentane Statement \(II\) : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from the options given below:NEET 2024 Medium
- The basic structural unit of silicates isNEET 2013 Medium
- Which of the following reactions will NOT give primary amine as the product?NEET 2023 Medium
- Toluene in the vapour phase is in equilibrium with a solution of benzene and toluene having mole fraction of toulene \(0.50\) If vapour pressure of pure benzene is \(119\, torr\) and that of toluene is \(37.0\) \(torr\) at the same temperature, mole fraction of toluene in vapour phase will be:NEET 2017 Medium
- Consider the following reaction for which the change in enthalpy is positive \(2 A ( g ) + B ( g ) \rightleftharpoons C ( g )+ D ( g )\) Which of the following will not affect the equilibrium?NEET 2017 Easy
More PYQs from NEET
- A mixture of gases contains \(H_2\) and \(O_2\) gases in the ratio of \(1 : 4\ (w/w).\) What is the molar ratio of the two gases in the mixture?NEET 2015 Hard
- A sagittal section of human brain is shown here. Identify at least two labels from \(A-D\).
NEET 2013 Medium - Which of the following is incorrect statement ?NEET 2019 Easy
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- The incorrect statement about the property of a Zener diode isNEET 2022 Medium
- The mixture which shows positive deviation from Raoult's law isNEET 2020 Medium