NEET · Chemistry · STD 12 - 5. Co-ordination chemistry
Ethylene diaminetetraacetate \((EDTA)\) ion is :
- A Hexadentate ligand with four \("O"\) and two \("N"\) donor atoms
- B Unidentate ligand
- C Bidentate ligand with two \("N''\) donor atoms
- D Tridentate ligand with three \("N"\) donor atoms
Answer & Solution
Correct Answer
(A) Hexadentate ligand with four \("O"\) and two \("N"\) donor atoms
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Chemistry
- Which of the following orders of ionic radii is correctly represented ?NEET 2014 Medium
- Under isothermal and reversible conditions, the term "free energy" in thermodynamics signifiesNEET 2017 Easy
- In the Kjeldahl's method for estimation of nitrogen present in a soil sample, ammonia evolved from \(0.75\, g\) of sample neutralized \(10\, mL\) of \(1\, M \,H_2SO_4.\) The percentage of nitrogen in the soil isNEET 2014 Hard
- Identify the final product [D] obtained in the following sequence of reactions.
NEET 2023 Hard - Match List\(-l\) with List\(-ll\) :
Choose the correct answer from the options given below.List\(-I\) (Oxoacids of Sulphur) List\(-II\) (Bonds) \(A\). Peroxodisulphuric acid \(I\). Two \(S - OH\), Four \(S = O\), One \(S - O - S\) \(B\). Sulphuric acid \(II\). Two \(S - OH\), One \(S = O\) \(C\). Pyrosulphuric acid \(III\). Two \(S - OH\), Four \(S = O\), One \(S - O - O - S\) \(D\). Sulphurous acid \(IV\). Two \(S - OH\), Two \(S = O\) NEET 2023 Medium - Hydrolysis of sucrose is glven by the following reactlon. Sucrose \(+\) \(H _{2} O \rightleftharpoons\) Glucose \(+\) Fructose If the equilibrium constant \(\left( K _{c}\right)\) is \(2 \times 10^{13}\) at \(300\, K\), the value of \(\Delta_{ r } G^{\Theta}\) at the same temperature will be:NEET 2020 Medium
More PYQs from NEET
- The charge flowing through a resistance \(R\) varies with time \(t\) as \( Q=at-bt^2 \) where \(a\) and \(b\) are positive constants . The total heat produced in \(R\) isNEET 2016 Hard
- Which one of the following statements is correct regarding sexually transmitted diseases \((STDs)\) ?NEET 2013 Medium
- Male and female gametophytes do not have an independent free living existence in what?NEET 2020 Easy
- In India, the organisation responsible for assessing the safety of introducing genetically modified organisms for public use isNEET 2018 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Consider the following statements :
\(A\). Annelids are true coelomates
\(B\). Poriferans are pseudocoelomates
\(C\). Aschelminthes are acoelomates
\(D\). Platyhelminthes are pseudocoelomates.
Choose the correct answer from the options given below :NEET 2024 Medium