NEET · Chemistry · STD 11 -p-Block elements - I
\(AlF_3\) is soluble in \(HF\) only in presence of \(KF.\) It is due to the formation of
- A \(K_3[AlF_3H_3]\)
- B \(K_3[AlF_6]\)
- C \(AlH_3\)
- D \(K[AlF_3H]\)
Answer & Solution
Correct Answer
(B) \(K_3[AlF_6]\)
Step-by-step Solution
Detailed explanation
\(\mathrm{AIF}_{3}+\mathrm{KF} \stackrel{H F}{\longrightarrow} \mathrm{K}_{3}\left[\mathrm{AIF}_{6}\right]\) maximum \(C.N.\) of \(A l^{+3}\) is six so it forms \(AlF_{6}^{3-}\)
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Chemistry
- Which among the following is a paramagnetic complex? \((\)At. No. \(Mo = 42, Pt = 78)\)NEET 2013 Medium
- Which of the following molecules is non-polar in nature?NEET 2021 Easy
- The decomposition of phosphine \((PH_3)\) on tungsten at low pressure is a first-order reaction. It is because theNEET 2016 Medium
- Accumulation of lactic acid \((HC_3H_5O_3),\) a monobasic acid in tissues leads to pain and a feeling of fatigue. In a \(0.10\, M\) aqueous solution, lactic acid is \(3.7\%\) dissociates. The value of dissociation constant, \(K_a,\) for this acid will beNEET 2013 Hard
- \(\mathrm{BF}_{3}\) is planar and electron deficient compound. Hybridization and number of electrons around the central atom, respectively are:NEET 2021 Medium
- The calculated 'spin-only' magnetic moment of \(Ti ^{2+}\left(3 d^2\right)\) is :NEET 2026 Hard
More PYQs from NEET
- The half life of a radioactive substance is \(20\) minutes. In \(........\,minutes\) time,the activity of substance drops to \(\left(\frac{1}{16}\right)^{ th }\) of its initial value.NEET 2023 Medium
- Which of the following equations depicts Verhulst-Pearl logistic population growth ?NEET 2026 Easy
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- When copper is heated with conc. \(HNO_3\) it producesNEET 2016 Medium
- A circular coil of radius \(10\; cm \;,\;500\) turns and resistance \(2\; \Omega\) is placed with its plane, perpendicular to the horizontal component of the earth's magnetic field. It is rotated about its vertical diameter through \(180^{\circ}\) in \(0.25\; s\). The induced e.m.f in the coil is (Take \(H E=\left.3.0 \times 10^{-5} \;T\right)\)NEET 2017 Medium
- Which of the following statements is correct?NEET 2013 Medium