enEnglishguગુજરાતી
NEET · Biology · STD 11 - 18. Neural control and coordination
Which part of the brain is responsible for thermoregulation?
- A Cerebrum
- B Hypothalamus
- C Corpus callosum
- D Medulla oblongata
Answer & Solution
Correct Answer
(B) Hypothalamus
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Match Column \(- I\) with Column \(- II.\)
\([Image]\)
Select the correct answer from the options given below.
\((a) -(b)- (c)- (d)\)
NEET 2021 Medium - If the length of a \(DNA\) molecule is \(1.1\) metres, what will be the approximate number of base pairs?NEET 2022 Medium
- Flowers are unisexual inNEET 2015 Medium
- Match the placental types (Column\(-I\)) with their examples (Column\(-II\))
Choose the correct answer from the following optionsColumn\(-I\) Column\(-II\) \((a)\) Basal \((i)\) Mustard \((b)\) Axile \((ii)\) China rose \((c)\) Parietal \((iii)\) Dianthus \((d)\) Free central \((iv)\) Sunflower NEET 2019 Hard - Match List \(I\) with List \(II\) :
Choose the correct answer from the options given below:List \(I\) List \(II\) \(A\) Typhoid \(I\) Fungus \(B\) Leishmaniasis \(II\) Nematode \(C\) Ringworm \(III\) Protozoa \(D\) Filariasis \(IV\) Bacteria NEET 2024 Medium - Given below are two statements: Statement \(I\):The primary \(CO _{2}\) acceptor in \(C _{4}\) plants is phosphoenolpyruvate and is found in the mesophyll cells. Statement \(II:\)Mesophyll cells of \(C _{4}\) plants lack RuBisCo enzyme. In the light of the above statements, choose the correct answer from the options given below:NEET 2022 Medium
More PYQs from NEET
- A body welghs \(200 \;\mathrm{N}\) on the surface of the earth. ......\(N\) will it weigh half way down to the centre of the earth?NEET 2019 Medium
- Identify the part of a bio-reactor which is used as a foam braker from the given figure.
NEET 2025 Easy - Which of the following is a free radical substitution reaction?NEET 2020 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known asNEET 2024 Medium
- The function of the gap junction is toNEET 2015 Medium