NEET · Biology · STD 12 - 5. molecular basis of inheritance
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?
- A 3' ATCGATCGATCGATCGATCGATCGATCG 5'
- B 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
- C 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
- D 5' ATCGATCGATCGATCGATCGATCGATCG 3'
Answer & Solution
Correct Answer
(D) 5' ATCGATCGATCGATCGATCGATCGATCG 3'
Step-by-step Solution
Detailed explanation
The sequence of coding strand is same as RNA except thymine at the place of uracil. Template strand \(\rightarrow\) 3'-TAGCTAGCTAGCTAGCTAGCTAGCTAGC-5'
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Which of the following is the least likely to be involved in stabilising the three dimensional folding of most proteins?NEET 2016 Medium
- The most abundant intracellular cation isNEET 2013 Medium
- The production of gametes by the parents, the formation of zygotes the \(F_1\) and \(F_2\) plants, can be understood usingNEET 2019 Medium
- Frogs respire in water by skin and buccal cavity and on land by skin, buccal cavity and lungs.
Choose the correct answer from the following :NEET 2025 Easy - Which one of the following equipments is essentially required for growing microbes on a large scale, for Industrial production of enzymes?NEET 2019 Medium
- During Meiosis - I, in which stage synapsis takes place?NEET 2020 Easy
More PYQs from NEET
- A tuning fork with frequency \(800 \;\mathrm{Hz}\) produces resonance in a resonance column tube with upper end open and lower end closed by water surface. Surface. Successive resonance are observed at length \(9.75 \;\mathrm{cm}, 31.25\; \mathrm{cm}\) and \(52.75\; \mathrm{cm} .\) The speed of sound in air is ......\(m/s\)NEET 2019 Medium
- The \(K_{sp}\) of \(Ag_2CrO_4, AgCl, AgBr\) and \(AgI\) are respectively, \(1.1 \times 10^{-12}, 1.8 \times 10^{-10},\)\( 5.0 \times 10^{-13}, 8.3 \times 10^{-17}.\) Which one of the following salts will precipitate last if \(AgNO_3\) solution is added to the solution containing equal moles of \(NaCl, NaBr, NaI\) and \(Na_2CrO_4\) ?NEET 2015 Hard
- The kinetic energies of two similar cars \(A\) and \(B\) are 100 J and 225 J respectively. On applying breaks, car A stops after 1000 m and car B stops after 1500 m . If \(F _{ A }\) and \(F _{ B }\) are the forces applied by the breaks on cars A and B , respectively, then the ratio \(F _{ A } / F _{ B }\) is :NEET 2025 Easy
- Which one of the folowing ions is not tetrahedral in shape?NEET 2017 Medium
- The coconut water from tender coconut representsNEET 2016 Medium
- Which one of the following statements is not true about the universal rules of binomial nomenclature ?NEET 2026 Hard