NEET · Biology · STD 12 - 4. principal of inheritance and variation
Which of the following statements are true with reference to the sex-determination in honeybees ?
A. An offspring formed from the union of a sperm and an egg, develops as a female (queen or worker).
B. An unfertilized egg develops as a male by parthenogenesis.
C. A male has half the number of chromosomes than that of a female.
D. Males produce sperms by meiosis.
E. Honeybees have a haplodiploid sex-determination system.
Choose the correct answer from the options given below :
- A A, B, C and E only
- B B, C, D and E only
- C A, B, C and D only
- D A, B, D and E only
Answer & Solution
Correct Answer
(A) A, B, C and E only
Step-by-step Solution
Detailed explanation
(A) A, B, C and E only
In honeybees, sex determination is based on the haplodiploid system.
Statement A is correct. Fertilized eggs (diploid) develop into females, which can be either queens or workers depending on their nutrition.
Statement B is correct. Unfertilized eggs develop into males (drones) through parthenogenesis.
Statement C is correct. Males are haploid \((n=16)\) and females are diploid \((2 n=32)\), so males have half the number of chromosomes compared to females.
Statement D is incorrect. Since males are already haploid, they produce sperms by mitosis, not meiosis.
Statement E is correct. This entire mechanism is known as the haplodiploid sex-determination system.
Therefore, statements A, B, C, and E are correct.
In honeybees, sex determination is based on the haplodiploid system.
Statement A is correct. Fertilized eggs (diploid) develop into females, which can be either queens or workers depending on their nutrition.
Statement B is correct. Unfertilized eggs develop into males (drones) through parthenogenesis.
Statement C is correct. Males are haploid \((n=16)\) and females are diploid \((2 n=32)\), so males have half the number of chromosomes compared to females.
Statement D is incorrect. Since males are already haploid, they produce sperms by mitosis, not meiosis.
Statement E is correct. This entire mechanism is known as the haplodiploid sex-determination system.
Therefore, statements A, B, C, and E are correct.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- During Meiosis - I, in which stage synapsis takes place?NEET 2020 Easy
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Dr. F. Went noted that if coleoptile tips were removed and placed on agar for one hour, the agar would produce a bending when placed on one side of freshlycut coleoptile stumps. Of what significance is this experiment ?NEET 2014 Medium
- Which is the important site of formation of glycoproteins and glycolipids in eukaryotic cells ?NEET 2020 Easy
- In sea urchin \(DNA\), which is double stranded, \(17\%\) of the bases were shown to be cytosine.The percentages of the other three basesexpected to be present in this \(DNA\) areNEET 2015 Medium
- Which one of the following statement is not true regarding gel electrophoresis technique?NEET 2022 Medium
More PYQs from NEET
- Which of the following lanthanoid ions is diamagnetic ? (At. nos. \(Ce = 58, Sm = 62,\)\( Eu = 63, Yb = 70\))NEET 2013 Medium
- Which of the following most appropriately describes haemophilia?NEET 2016 Medium
- Which one of the following disorders is caused by the substitution of Glutamic acid (Glu) by Valine (Val) at the sixth position of the beta globin chain of the haemoglobin molecule ?NEET 2026 Easy
- Compound \(X\) on reaction with \(O _{3}\) followed by \(Zn /\) \(H _{2} O\) gives formaldehyde and \(2-\)methyl propanal as products. The compound \(X\) is :NEET 2022 Easy
- The partial pressures (in \(\mathrm{mm}\, \mathrm{Hg}\) ) of oxygen \(\left(\mathrm{O}_{2}\right)\) and carbon dioxide \(\left(\mathrm{CO}_{2}\right)\) at alveoli (the site of diffusion) are:NEET 2021 Medium
- Match List\(- I\) with List \(- II\) :
Choose the correct answer from the options given below :List\(- I\) List \(- II\) (a) Chlamydomonas (i) Moss (b) Cycas (ii) Pteridophyte (c) Selaginella (iii) Alga (d) Sphagnum (iv) Gymnosperm NEET 2022 Medium