NEET · Biology · STD 12 - 9. biotechnology principlas and process
Which of the following is not a cloning vector?
- A Probe
- B BAC
- C YAC
- D pBR322
Answer & Solution
Correct Answer
(A) Probe
Step-by-step Solution
Detailed explanation
Option (1) is correct answer because a single stranded DNA or RNA tagged with a radioactive molecule is called a probe and it helps in the detection of mutated gene. Option (2), (3) and (4) are not correct because YAC, BAC, pBR322 are vectors.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- In \(RNAi\), the genes are silenced usingNEET 2019 Medium
- Identify the set of correct statements: \(A\). The flowers of Vallisneria are colourful and produce nectar. \(B\). The flowers of water lily are not pollinated by water. \(C\). In most of water-pollinated species, the pollen grains are protected from wetting. \(D\). Pollen grains of some hydrophytes are long and ribbon like. \(E\). In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below.NEET 2024 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- What is the genetic disorder in which an individual has an overall masculine development, gynaecomastla, and is sterile?NEET 2019 Medium
- Methanogens belong toNEET 2016 Medium
- Which statement is wrong for Krebs’ cycle?NEET 2017 Medium
More PYQs from NEET
- The phenomenon of evolution of different species in a given geographical area starting from a point and spreading to other habitats is calledNEET 2020 Easy
- A ball is thrown vertically downward with a velocity of \(20\; m / s\) from the top of a tower. It hits the ground after some time with a velocity of \(80\, m / s\). The helght of the tower is \(......m\) : \(\left( g =10\, m / s ^{2}\right)\)NEET 2020 Easy
- Melotic division of the secondary oocyte is completedNEET 2020 Medium
- Two statements are given below :
A. When the forward bias voltage across a p-n junction diode increases above a certain threshold voltage, the diode current increases significantly.
B. This current is called reverse saturation current.
Choose the correct answer from the options given below :NEET 2026 Medium - If \(\mathrm{E}\) and \(\mathrm{G}\) respectively denote energy and gravitational constant, then \(\frac{\mathrm{E}}{\mathrm{G}}\) has the dimensions of :NEET 2021 Medium
- Pinus seed cannot germinate and establish without fungal association. This is becauseNEET 2019 Medium