NEET · Biology · STD 12 - 9. biotechnology principlas and process
Which of the following is commonly used as a vector for introducing a \(DNA\) fragment in human lymphocytes?
- A \(pBR\,322\)
- B \(Ti\,plasmid\)
- C \(\lambda\) phage
- D Retrovirus
Answer & Solution
Correct Answer
(D) Retrovirus
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Cuboidal epithelium with brush border of microvilli is found in :NEET 2020 Easy
- If Adenine makes \(30\, \%\) of the \(DNA\) molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?NEET 2021 Hard
- Match the following columns and select the correct option
\((a)\quad(b)\quad(c)\quad(d)\)Column\(-I\) Column\(-II\) \((a)\) Pituitary gland \((i)\) Grave's disease \((b)\) Thyroid gland \((ii)\) Diabetes mellitus \((c)\) Adrenal gland \((iii)\) Diabetes insipidus \(Z(d)\) Pancreas \((iv)\) Addision's disease NEET 2020 Easy - Radial symmetry is found in the flowers ofNEET 2016 Medium
- Match the placental types (Column\(-I\)) with their examples (Column\(-II\))
Choose the correct answer from the following optionsColumn\(-I\) Column\(-II\) \((a)\) Basal \((i)\) Mustard \((b)\) Axile \((ii)\) China rose \((c)\) Parietal \((iii)\) Dianthus \((d)\) Free central \((iv)\) Sunflower NEET 2019 Hard - Given below are two statements: Statement \(I:\) Decomposition is a process in which the detritus is degraded into simpler substances by microbes. Statement \(II:\) Decomposition is faster if the detritus is rich in lignin and chitin In the light of the above statements, choose the correct answer from the options given below:NEET 2022 Hard
More PYQs from NEET
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Which one of the following equipments is essentially required for growing microbes on a large scale, for Industrial production of enzymes?NEET 2019 Medium
- The standard electrode potentlal (\(E^-\)) values of \(\mathrm{Al}^{3+} / \mathrm{Al}, \mathrm{Ag}^{+} / \mathrm{Ag}, \mathrm{K}^{+} / \mathrm{K}\) and \(\mathrm{Cr}^{3+} / \mathrm{Cr}\) are \(-1.66 \;\mathrm{V}, 0.80 \;\mathrm{V}\) \(-2.93\; \mathrm{V}\) and \(-0.74\; \mathrm{V},\) respectively. The correct decreasing order of reducing power of the metal isNEET 2019 Medium
- A solld cylinder of mass \(2 \;\mathrm{kg}\) and radius \(50 \;\mathrm{cm}\) rolls up an inclined plane of angle inclination \(30^{\circ}\). The centre of mass of cyllnder has speed of \(4 \;\mathrm{m} / \mathrm{s}\). The distance travelled by the cyllinder on the incline surface will be ......\(m\)NEET 2019 Medium
- A light bulb and an inductor coil are connected to an ac source through a key as shown in the figure below. The key is closed and after sometime an iron rod is inserted into the interior of the inductor. The glow of the light bulb
NEET 2020 Medium - Which of the following statement is not true about glucose?NEET 2020 Medium