NEET · Biology · STD 12 - 2. human reproduction
Which of the following cells during gametogenesis is normally diploid ?
- A Spermatogonia
- B Secondary polar body
- C Primary polar body
- D Spermatid
Answer & Solution
Correct Answer
(A) Spermatogonia
Step-by-step Solution
Detailed explanation
(a) : Spermatogonia are diploid cells which mature into primary spermatocytes \((2n)\) by growth. They then produce two haploid secondary spermatocytes by meiosis \(I\). Each secondary spermatocyte \((n)\) completes the meiosis II and produces two spermatids \((n)\). Each spermatid \((n)\) develops into a spermatozoan or sperm \((n)\). Similarly, in females, oogonia are the diploid cells from which through meiosis, polar bodies \((n)\) and single ovum \((n)\) are produced.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- The species confined to a particular region and not found elsewhere is termed asNEET 2015 Medium
- Which of the following statements are correct with reference to human endoskeleton ?
A. Human skull is monocondylic.
B. The joint between any two adjoining vertebrae is a cartilaginous joint.
C. In human beings, the number of cervical vertebrae is seven.
D. All ribs except the last 2 pairs are bicephalic.
E. The occipital bone of skull is articulated with atlas vertebra.
Choose the correct answer from the options given below :NEET 2026 Easy - Life cycles of Ectocarpus and Fucus respectively areNEET 2017 Medium
- Glenoid cavity articulatesNEET 2015 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Cell wall is absent inNEET 2015 Medium
More PYQs from NEET
- The introduction of \(T-DNA\) into plants involvesNEET 2015 Medium
- Which of the following lanthanoids shows \(+4\) oxidation state to acquire noble gas configuration? (At nos. : \(L a=57, C e=58, E u=63\) and \(Y b=70\) )NEET 2017 Easy
- Which of the following statements are correct ?
A. Inside a conductor, the electrostatic field is zero.
B. Electric field at the surface of a charged conductor does not depend on its surface charge density.
C. The interior of a charged conductor can have no excess charge in the static situation.
D. At the surface of a charged conductor, the electrostatic field must be normal to the surface at every point.
E. The electrostatic potential is zero everywhere inside a charged conductor.
Choose the correct answer from the options given below :NEET 2026 Hard - Tropical regions show greatest level of species richness because \(A\). Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. \(B\). Tropical environments are more seasonal. \(C\). More solar energy is available in tropics. \(D\). Constant environments promote niche specialization. \(E\). Tropical environments are constant and predictable. Choose the correct answer from the options given below.NEET 2024 Medium
- Given below are certain reactions. Identify the reaction for which \(K_p \neq K_c:\)NEET 2026 Easy
- Which of the following is incorrect for windpollinated plants?NEET 2020 Easy