enEnglishguગુજરાતી
NEET · Biology · STD 12 - 10. biotechnology and its application
Which of the following \(Bt\) crops is being grown in India by the farmers?
- A Brinjal
- B Soybean
- C Maize
- D Cotton
Answer & Solution
Correct Answer
(D) Cotton
Step-by-step Solution
Detailed explanation
(d) : \(Bt\) toxin genes were isolated from Bacillus thuringiensis and incorporated into the several crop plants such as cotton. The choice of genes depends upon the crop and targeted pest, as most \(Bt\) toxins are insectgroup specific. The toxin is coded by a gene named cry. These are numerous genes. Two cry genes cry \(I\ Ac\) and cry \(II\ Ab\) have been incorporated in cotton. The genetically modified crop is called \(Bt\) cotton as it contains \(Bt\) toxin genes against cotton bollworms.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- Tropical regions show greatest level of species richness because \(A\). Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. \(B\). Tropical environments are more seasonal. \(C\). More solar energy is available in tropics. \(D\). Constant environments promote niche specialization. \(E\). Tropical environments are constant and predictable. Choose the correct answer from the options given below.NEET 2024 Medium
- \(MALT\) constitutes about _______ percent of the lymphoid tissue in human body.NEET 2017 Medium
- Between which among the following, the relationship is not an example of commensalism?NEET 2019 Easy
- Which part of poppy plant is used to obtain the drug \(“Smack”\)?NEET 2018 Medium
- Which one of these animals is not a homeotherm?NEET 2018 Medium
More PYQs from NEET
- Reaction of a carbonyl compound with one of the following reagents involves nucleophilic addition followed by elimination of water. The reagent isNEET 2015 Medium
- A parallel beam of light of wavelength \(\lambda\) is incident normally on a single slit of width \(d\). Diffraction bands are obtained on a screen placed at a distance \(D\) from the slit. The second dark band from the central bright band will be at a distance given byNEET 2017 Easy
- Cortex is the region found betweenNEET 2016 Medium
- A specialised nodal tissue embedded in the lower corner of the right atrium, close to Atrio-ventricular septum, delays the spreading of impulses to heart apex for about \(0.1\; sec\). The delay allows.NEET 2019 Easy
- Identify the incorrect statement.NEET 2020 Easy
- In the following in each set a conservation approach and an example of method of conservation are given
(\(a\)) In situ conservation - Biosphere Reserve
(\(b\)) Ex situ conservation - Sacred groves
(\(c\)) In situ conservation - Seed bank
(\(d\)) Ex situ conservation - Cryopreservation
Select the option with correct match of approach and methodNEET 2020 Easy