NEET · Biology · STD 11 - 19. Chemical coordination and integration
Which of the following are not the effects of Parathyroid hormone? \((a)\) Stimulates the process of bone resorption \((b)\) Decreases \(Ca ^{2+}\) level in blood \((c)\) Reabsorption of \(Ca ^{2}+\) by renal tubules \((d)\) Decreases the absorption of \(Ca ^{2+}\) from digested food \((e)\) Increases metabolism of carbohydrates Choose the most appropriate answer from the options given below:
- A \((b), (d)\) and \((e)\) only
- B \((a)\) and \((e)\) only
- C \((b)\) and \((c)\) only
- D \((a)\) and \((c)\) only
Answer & Solution
Correct Answer
(A) \((b), (d)\) and \((e)\) only
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Match List \(I\) with List \(II\) :Choose the correct answer from the options given below :
List \(I\) List \(I\) \(A\) Exophthalmic goiter \(I\) Excess secretion of cortisol, moon face hypergylcemia. \(B\) Acromegaly \(II\) Hypo-secretion of thyroid hormone and stunted growth. \(C\) Cushing's syndrome \(III\) Hyper secretion of thyroid hormone protruding eye balls. \(D\) Cretinism \(IV\) Excessive secretion of growth hormone. NEET 2024 Medium - List of endangered species was released byNEET 2024 Medium
- Hormones stored and released from neurohypophysis areNEET 2020 Easy
- Given below are two statements : one is labelled as Assertion \(A\) and the other is labelled as Reason \(R\) : Assertion \(A\) : FSH acts upon ovarian follicles in female and Leydig cells in male. Reason \(R\) : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below :NEET 2024 Medium
- A stage of mitosis is shown in the diagram. Which stage is it and what are its characteristics?
NEET 2013 Easy - A major site for synthesis of lipids isNEET 2013 Medium
More PYQs from NEET
- Match List \(I\) with List \(II\) :
Choose the correct answer from the options given below :List \(I\) List \(II\) \(A.\) Pleurobrachia \(I.\) Mollusca \(B.\) Radula \(II.\) Ctenophora \(C.\) Stomochord \(III.\) Osteichthyes \(D.\) Air bladder \(IV.\) Hemichordata NEET 2024 Medium - Which of the following are fused in somatic hybridization involving two varieties of plants?NEET 2024 Medium
- Two metal spheres, one of radus \(R\) and the other of radius \(2 R\) respectively have the same surface charge density \(\sigma\). They are brought in contact and separated. What will be the new surface charge densities on them?NEET 2019 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Match List I with List II :
Choose the correct answer from the options given below :List I (Drug) List II (Effect) A. Nicotine I. Causes sense of euphoria and increased energy B. Morphine II. Stimulates adrenal gland to release catecholamines into blood circulation C. Heroin III. Effective sedative and painkiller D. Cocaine IV. A depressant; slows down body function NEET 2026 Medium - Match List \(I\) with List \(II\) :
Choose the correct answer from the options given below :List \(I\) List \(II\) \(A.\) Fibrous joints \(I.\) Adjacent vertebrae, limited movement \(B.\) Cartilaginous joints \(II.\) Humerus and Pectoral girdle, rotational movement \(C.\) Hinge joints \(III.\) Skull, don't allow any movement \(D.\) Ball and socket joints \(IV.\) Knee, help in locomotion NEET 2024 Medium