enEnglishguગુજરાતી
NEET · Biology · STD 12 - 4. principal of inheritance and variation
Which idea is depicted by a cross in which the \(F_1\) generation resembles both the parents?
- A Inheritance of one gene
- B Codominance
- C Incomplete dominance
- D Complete dominance
Answer & Solution
Correct Answer
(B) Codominance
Step-by-step Solution
Detailed explanation
(b): In codominance, both the alleles are able to express themselves independently when present together resulting in a phenotype that is intermediate between both the parental homozygous phenotypes, thereby resembling both of them. \(E.g.\), roan coat colour in cattle is a result of codominance of alleles for white and red coat colour.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Which of the following type of immunity is present at the time of birth and is a non-specific type of defence in the human body?NEET 2025 Easy
- Which type of tissue correctly matches with its location ?
Tissue Location \((a)\) Transitional epithelium Tip of nose \((b)\) Cuboidal epithelium Lining of stomach \((c)\) Smooth muscle Wall of intestine \((d)\) Areolar tissue Tendons NEET 2016 Medium - The crops engineered for glyphosate are resistant/tolerant toNEET 2015 Medium
- The specific receptors for neurotransmitters in a synapse are present on :NEET 2026 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Detritivores breakdown detritus into smaller particles. This process is called :NEET 2022 Medium
More PYQs from NEET
- Axile placentation is observed inNEET 2023 Medium
- Boric acid is an acid because its moleculeNEET 2016 Medium
- \(RNA\) interference involvesNEET 2013 Medium
- Match List \(I\) with List \(II\)
Choose the correct answer from the options given below :List \(I\) List \(II\) (A). Rose (I). Twisted aestivation (B). Pea (II). Perigynous flower (C). Cotton (III). Drupe (D). Mango (IV). Marginal placentation NEET 2024 Medium - The impact of immigration on population density isNEET 2020 Easy
- What happens to the mass number and atomic number of an element when it emits \(\gamma\)-radiation?NEET 2020 Easy