NEET · Biology · STD 11 - 13. Plant growth and development
Typical growth curve in plants is
- A stairsteps shaped
- B parabolic
- C sigmoid
- D linear.
Answer & Solution
Correct Answer
(C) sigmoid
Step-by-step Solution
Detailed explanation
(c) : Geometric growth cannot be sustained for long in natural condition. Limited nutrient availability slows down the growth. It leads to a stationary phase or even a decline. Plotting the growth against time, gives a typical sigmoid or Scurve. Sigmoid curve of growth is typical of most organisms in their natural environment including plants.An idealised sigmoid growth curve is drawn below:
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Which is the important site of formation of glycoproteins and glycolipids in eukaryotic cells ?NEET 2020 Easy
- What is the probability of having children with 'O' blood group, where both mother and father are heterozygous for 'A' and 'B' blood group, respectively ?NEET 2026 Hard
- Which of the following statements with respect to Endoplasmic Reticulum is incorrect?NEET 2022 Easy
- Read the following five statements \((A\) to \(E)\) and select the option with all correct statements.
\(A.\) Mosses and lichens are the first organisms to colonise a bare rock.
\(B.\) Selaginella is a homosporous pteridophyte.
\(C.\) Coralloid roots in Cycas have \(VAM\).
\(D.\) Main plant body in bryophytes is gametophytic, whereas in pteridophytes it is sporophytic.
\(E.\) In gymnosperms, male and female gametophytes are present within sporangia located on sporophyte.NEET 2015 Medium - The fruit fly has \(8\) chromosomes \((2 n)\) in each cell. During interphase of Mitosis if the number of chromosomes at \(\mathrm{G}_{1}\) phase is \(8 ,\) what would be the number of chromosomes after \(S\) phase ?NEET 2021 Medium
- Which of the following statements is not correct?NEET 2019 Medium
More PYQs from NEET
- Given below are two statements: Statement \(I:\) Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement \(II:\) The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:NEET 2023 Medium
- Select the correct option.NEET 2019 Medium
- Which of the following statements about the interstitial compounds is incorrect?NEET 2013 Hard
- The net impedance of circuit (as shown in figure) will be \(...........\,\Omega\)
NEET 2023 Medium - Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- Name the chronic respiratory disorder caused mainly by cigarette smoking.NEET 2016 Medium