NEET · Biology · STD 12 - 6. evolution
The similarity of bone structure in the forelimbs of many vertebrates is an example of
- A Adaptive radiation
- B Homology
- C Convergent evolution
- D Analogy
Answer & Solution
Correct Answer
(B) Homology
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- According to Alexander von HumboldtNEET 2020 Easy
- The rate of decomposition is faster in the ecosystem due to following factors \(EXCEPT\)NEET 2020 Easy
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- The three boxes in this diagram represent the three major biosynthetic pathways in aerobic respiration. Arrows represent net reactants or products.Arrows numbered \(4, 8\) and \(12\) can all be
NEET 2013 Medium - Menstrual flow occurs due to lack ofNEET 2013 Medium
- Match List\(- I\) with List \(- II\) :
Choose the correct answer from the options given below :List\(- I\) List \(- II\) (a) Chlamydomonas (i) Moss (b) Cycas (ii) Pteridophyte (c) Selaginella (iii) Alga (d) Sphagnum (iv) Gymnosperm NEET 2022 Medium
More PYQs from NEET
- Match List I with List II :
Choose the correct answer from the options given below:List-I (Complex) List-II (Type of isomerism) (A) \(\left[ Pt \left( NH _3\right)_2 Cl _2\right]\) (I) Optical (B) \(\left[ Co ( en )_3\right]^{3+}\) (II) Solvate (C) \(\left[ Co \left( NH _3\right)_5 NO _2\right] Cl _2\) (III) Geometrical (D) \(\left[ Cr \left( H _2 O \right)_6\right] Cl _3\) (IV) Linkage NEET 2026 Hard - Genetic variation in a population arises due toNEET 2013 Medium
- Which of the following processes does not involve oxidation of iron?NEET 2015 Medium
- Given below are the stages in the life cycle of pteridophytes. Arrange the following stages in the correct sequence.
A. Prothallus stage
B. Meiosis in spore mother cells
C. Fertilisation
D. Formation of archegonia and antheridia in gametophyte.
E. Transfer of antherozoids to the archegonia in presence of water.
Choose the correct answer from the options given below:NEET 2025 Medium - Which one of the following are analogous structures?NEET 2014 Medium
- Which one of the following is a non reducing carbohydrate?NEET 2014 Medium