NEET · Biology · STD 11 - 4. Animal kingdom
Select the set of fishes which belong to the class Osteichthyes :
- A Devil fish, Cuttlefish and Hagfish
- B Saw fish, Fighting fish and Dog fish
- C Starfish, Hagfish and Cuttlefish
- D Flying fish, Angel fish and Fighting fish
Answer & Solution
Correct Answer
(D) Flying fish, Angel fish and Fighting fish
Step-by-step Solution
Detailed explanation
(D) Flying fish, Angel fish and Fighting fish
Flying fish (Exocoetus), Angel fish (Pterophyllum), and Fighting fish (Betta) are all bony fishes belonging to the class Osteichthyes.
Devil fish (Octopus) and Cuttlefish (Sepia) belong to the phylum Mollusca.
Hagfish (Myxine) belongs to the class Cyclostomata.
Saw fish (Pristis) and Dog fish (Scoliodon) belong to the class Chondrichthyes (cartilaginous fishes).
Starfish (Asterias) belongs to the phylum Echinodermata.
Flying fish (Exocoetus), Angel fish (Pterophyllum), and Fighting fish (Betta) are all bony fishes belonging to the class Osteichthyes.
Devil fish (Octopus) and Cuttlefish (Sepia) belong to the phylum Mollusca.
Hagfish (Myxine) belongs to the class Cyclostomata.
Saw fish (Pristis) and Dog fish (Scoliodon) belong to the class Chondrichthyes (cartilaginous fishes).
Starfish (Asterias) belongs to the phylum Echinodermata.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Given below are two statements : Statement \(I\): In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement \(II\) : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the option given below :NEET 2024 Medium
- The impact of immigration on population density isNEET 2020 Easy
- Five kingdom system of classification suggested by R.H. Whittaker is not based onNEET 2014 Medium
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- In the following palindromic base sequences of DNA, which one can be cut easily by particular restriction enzyme?NEET 2022 Medium
- Match List I with List II :
List I (Phase of cell cycle) List II (Activity) A. \(G_1\) phase I. Actual cell division occurs B. S phase II. Cell is metabolically active and continuously grows but does not replicate its DNA C. \(G_2\) phase III. Synthesis of DNA occurs and the amount of DNA per cell doubles D. M phase IV. Proteins are synthesized while cell growth continues NEET 2026 Hard
More PYQs from NEET
- Which of the following statements is incorrect?NEET 2021 Medium
- Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to \(\mathrm{VI}\). \(A\). \(Al^{3+}\) \(B\). \(Cu^{2+}\) \(C\). \(Ba^{2+}\) \(D\). \(Co^{2+}\) \(E\). \(Mg^{2+}\) Choose the correct answer from the options given below.NEET 2024 Medium
- A shell of mass \(m\) is at rest initially. It explodes into three fragments having mass in the ratio \(2: 2: 1\). If the fragments having equal mass fly off along mutually perpendicular directions with speed \(v\), the speed of the third (lighter) fragment is :NEET 2022 Hard
- A sphere of radius \(R\) is cut from a larger solid sphere of radius \(2 R\) as shown in the figure. The ratio of the moment of inertia of the smaller sphere to that of the rest part of the sphere about the Y-axis is _______.
NEET 2025 Hard - Read the following statements and choose the set of correct statements: \((a)\) Euchromatin is loosely packed chromatin \((b)\) Heterochromatin is transcriptionally active \((c)\) Histone octomer is wrapped by negatively charged DNA in nucleosome \((d)\) Histones are rich in lysine and arginine \((e)\) A typical nucleosome contains \(400\,bp\) of DNA helix Choose the correct answer from the options given below:NEET 2022 Medium
- A rectangular film of liquid is extended from \((4 \,\,cm \times 2\, cm)\) to \((5\,\, cm \times 4\, cm).\) If the work done is \(3 \times 10^{-4}\, J,\) the value of the surface tension of the liquid is ............ \(Nm^{-1}\)NEET 2016 Medium