NEET · Biology · STD 11 - 8. Cell the unit of life
Select the mismatch.
- A Gas vacuoles -Green bacteria
- B Large central vacuoles -Animal cells
- C Protists -Eukaryotes
- D Methanogens -Prokaryotes
Answer & Solution
Correct Answer
(B) Large central vacuoles -Animal cells
Step-by-step Solution
Detailed explanation
(b) : Large central vacuole is the characteristic of plant cell, not animal cell which may have many small scattered vacuoles.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Match the following columns and select the correct option:
Column \(I\) Column \(II\) (\(a\)) Dragonflies (\(i\)) Biocontrol agents of several plant pathogens (\(b\)) Bacillus (\(ii\)) Get rid of Aphids thuringiensis and mosquitoes (\(c\)) Glomus (\(iii\)) Narrow spectrum insecticidal applications (\(d\)) Baculoviruses (\(iv\)) Biocontrol agents of lepidoteran plant pests (\(v\)) Absorb phosphorus from soil NEET 2020 Easy - Receptor sites for neurotransmitters are present onNEET 2017 Medium
- For effective treatment of the disease, early diagnosis and understanding its pathophysiology is very important. Which of the following molecular diagnostic techniques is very useful for early detection?NEET 2021 Medium
- The protein portion of an enzyme is called _______.NEET 2025 Easy
- Match the following columns and select the correct option
\((a)\quad(b)\quad(c)\quad(d)\)Column\(-I\) Column\(-II\) \((a)\) Pituitary gland \((i)\) Grave's disease \((b)\) Thyroid gland \((ii)\) Diabetes mellitus \((c)\) Adrenal gland \((iii)\) Diabetes insipidus \(Z(d)\) Pancreas \((iv)\) Addision's disease NEET 2020 Easy - In a cymose inflorescence the main axisNEET 2013 Medium
More PYQs from NEET
- Match List \(I\) with List \(II\).
Choose the correct answer from the options give below:List \(I\) List \(II\) (A). Mast cells (I). Ciliated epithelium (B). Inner surface of bronchiole (II). Areolar connective tissue (C). Blood (III). Cuboidal epithelium (D). Tubular parts of nephron (IV). Specialised connective tissue NEET 2023 Medium - Which of the following is true for nucleolus ?NEET 2018 Easy
- \(6.02 \times 10^{20}\) molecules of urea are present in \(100\ mL\) of its solution. The concentration of solution is.....\(M\)NEET 2013 Hard
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- The angular acceleration of a body, moving along the circumference of a circle, is :NEET 2023 Easy
- In a uniform magnetic field of \(0.049 \mathrm{~T}\), a magnetic needle performs \(20\) complete oscillations in \(5\) seconds as shown. The moment of inertia of the needle is \(9.8 \times 10^{-5} \mathrm{~kg} \mathrm{~m}^2\). If the magnitude of magnetic moment of the needle is \(x \times 10^{-5} \mathrm{Am}^2\), then the value of ' \(x\) ' is :NEET 2024 Medium