NEET · Biology · STD 12 - 10. biotechnology and its application
\(RNA\) interference involves
- A synthesis of \(cDNA\) and \(RNA\) using reverse transcriptase
- B silencing of specific \(mRNA\) due to complementary \(RNA\)
- C interference of \(RNA\) in synthesis of \(DNA\)
- D synthesis of \(mRNA\) from \(DNA\)
Answer & Solution
Correct Answer
(B) silencing of specific \(mRNA\) due to complementary \(RNA\)
Step-by-step Solution
Detailed explanation
(b) : \(RNA\) interference \((RNAi)\) is the phenomenon of inhibiting activity of a gene through production of both sense and antisense \(RNA\). \(RNAi\) takes place in all eukaryotic organisms as a method of cellular defense. This method involves a specific \(mRNA\) silencing. It is due to a complementary \(dsRNA\) molecule which binds to and prevents translation of the \(mRNA\) causing its silencing.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- A temporaryendocrine gland in the human body isNEET 2017 Medium
- Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.NEET 2024 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- In angiosperms, root hairs arise from which one of the following regions of the root ?NEET 2026 Medium
- Consider the following statements regarding function of adrenal medullary hormones :
(A) It causes pupilary constriction.
(B) It is a hyperglycemic hormone.
(C) It causes piloerection.
(D) It increases strength of heart contraction.
Choose the correct answer from the options given below :NEET 2025 Medium - Following are the stages of cell division :
\(A\). Gap \(2\) phase
\(B\). Cytokinesis
\(C\). Synthesis phase
\(D\). Karyokinesis
\(E\). Gap \(1\) phase
Choose the correct sequence of stages from the options given below :NEET 2024 Medium
More PYQs from NEET
- Activation energy of any chemical reaction can be calculated if one knows the value ofNEET 2024 Medium
- The molar conductivity of \(0.007 \,\mathrm{M}\) acetic acid is \(20 \, \mathrm{~S} \, \mathrm{~cm}^{2} \,\mathrm{~mol}^{-1}\). What is the dissociation constant of acetic acid? (In \(\times 10^{-5} \,\mathrm{~mol} \,\mathrm{~L}^{-1}\)) \([\Lambda_{\mathrm{H}^{+}}^{\circ}=350 \,\mathrm{~S}\, \mathrm{~cm}^{2}\, \mathrm{~mol}^{-1},\Lambda_{\mathrm{CH}_{3} \mathrm{COO}^{-}}^{\circ}=50\, \mathrm{~S}\, \mathrm{~cm}^{2}\, \mathrm{~mol}^{-1}]\)NEET 2021 Medium
- The solubility product for a salt of the type \(AB\) is \(4 \times 10^{-8}\). What is the molarity of its standard solution?NEET 2020 Medium
- Which of the following has proved helpful in preserving pollen as fossils?NEET 2018 Easy
- Embryo with more than \(16\) blastomeres formed due to in vitro fertilisation is transferred intoNEET 2016 Medium
- In Antirrhinum (Snapdragon), a red flower was crossed with a white flower and in \(\mathrm{F}_{1}\) generation, pink flowers were obtained. When pink flowers were selfed, the \(\mathrm{F}_{2}\) generation showed white, red and pink flowers. Choose the incorrect statement from the followingNEET 2019 Easy