NEET · Biology · STD 11 - 10. Cell cycle and cell division
Regarding Meiosis, which of the statements is incorrect?
- A DNA replication occurs in \(S\) phase of Meiosis\(-II\)
- B Pairing of homologous chromosomes and recombination occurs in Meiosis\(-I\)
- C Four haploid cells are formed at the end of Meiosis\(-II\)
- D There are two stages in Meiosis, Meiosis\(-I\) and \(II\)
Answer & Solution
Correct Answer
(A) DNA replication occurs in \(S\) phase of Meiosis\(-II\)
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Given below are two statements : One is labelled as Assertion \(A\) and the other is labelled as Reason \(R\): Assertion \(A:\) \(ATP\) is used at two steps in glycolysis. Reason \(R:\) First \(ATP\) is used in converting glucose into glucose\(-6-\)phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose\(-1,6-\)diphosphate. In the light of the above statements, choose the correct answer from the options given below :NEET 2023 Medium
- Match List\(-I\) with List\(- II.\)
Choose the correct answer from the options given below. \((a)- (b)- (c)- (d)\)List\(-I\) List\(-II\) \((a)\) Vaults \((i)\) Entry of sperm through Cervix is blocked \((b)\) \(IUDs\) \((ii)\) Removal of Vas deferens \((c)\) Vasectomy \((iii)\) Phagocytosis of sperms within the Uterus \((d)\) Tubectomy \((iv)\) Removal of fallopian tube NEET 2021 Medium - The Earth Summit held in Rio de Janeiro in \(1992\) was calledNEET 2019 Medium
- Dr. F. Went noted that if coleoptile tips were removed and placed on agar for one hour, the agar would produce a bending when placed on one side of freshlycut coleoptile stumps. Of what significance is this experiment ?NEET 2014 Medium
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- When one \(CO _2\) molecule is fixed as one molecule of triose phosphate, which of the following photochemically made, high energy chemical intermediates are used in the reduction phase?NEET 2022 Hard
More PYQs from NEET
- At any instant of time \(t\), the displacement of any particle is given by \(2 t-1\) (\(SI\) unit) under the influence of force of \(5 \mathrm{~N}\). The value of instantaneous 10.Power is (in SI unit):NEET 2024 Medium
- A step down transformer connected to an ac mains supply of \(220\, \mathrm{~V}\) is made to operate at \(11 \,\mathrm{~V}, 44 \,\mathrm{~W}\) lamp. Ignoring power losses in the transformer, what is the current in the primary circuit? (In \(\mathrm{~A}\))NEET 2021 Medium
- Identify the part of a bio-reactor which is used as a foam braker from the given figure.
NEET 2025 Easy - The chromosomes in which centromere is situated close to one end areNEET 2015 Medium
- A tertiary butyl carbocation is more stable than a secondary butyl carbocation because of which of the following\(?\)NEET 2020 Medium
- Which of the following is required as inducer(s) for the expression of Lac operon?NEET 2016 Medium