NEET · Biology · STD 11 - 16. Excretory product and their elimination
Match the following parts of a nephron with their function
| \((a)\) Descending limb of Henle's loop | \((i)\) Reabsorption of salts only |
| \((b)\) Proximal Convoluted tubule | \((ii)\) Reabsorption of water only |
| \((c)\) Ascending limb of Henle's loop | \((iii)\) Conditional reabsorption of sodium ion and water |
| \((d)\) Distal convoluted tubule | \((iv)\) Reabsorption of ion, water and organic nutrients |
- A \((a)-(i), (b)-(iii), (c)-(ii), (d)-(iv)\)
- B \((a)-(ii), (b)-(iv), (c)-(i), (d)-(iii)\)
- C (a)-(i), (b)-(iv), (c)-(ii), (d)-(iii)
- D \((a)-(iv), (b)-(i), (c)-(iii), (d)-(ii)\)
Answer & Solution
Correct Answer
(B) \((a)-(ii), (b)-(iv), (c)-(i), (d)-(iii)\)
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- What is the probability of having children with 'O' blood group, where both mother and father are heterozygous for 'A' and 'B' blood group, respectively ?NEET 2026 Hard
- \(2\left( C _{51} H _{98} O _6\right)+145 O _2 \rightarrow 102 CO _2+98 H _2 O +\) energy
The Respiratory Quotient (RQ) of a biomolecule, used for respiration, as per the above equation would be :NEET 2026 Hard - Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Cuboidal epithelium with brush border of microvilli is found in :NEET 2020 Easy
- The yellowish fluid "colostrum" secreted by mammary glands of mother during the initial days of lactation has abundant antibodies (\(lgA\)) to protect the infant. This type of immunity is called asNEET 2020 Easy
- Why is a capsule advantageous to a bacterium ?NEET 2013 Medium
More PYQs from NEET
- Which of the following regions of the globe exhibits highest species diversity\(?\)NEET 2020 Easy
- Detritivores breakdown detritus into smaller particles. This process is called :NEET 2022 Medium
- Fruit and leaf drop at early stages can be prevented by the application ofNEET 2017 Medium
- Assertion \((A)\):All vertebrates are chordates but all chordates are not vertebrates.
Reason \((R)\):Notochord is replaced by vertebral column in the adult vertebrates.
In the light of the above statements, choose the most appropriate answer from the options given below:NEET 2022 Medium - \(AGGTATCGCAT\) is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed \(mRNA\)?NEET 2018 Hard
- Which of the following conditions cause erythroblastosis foetalis?NEET 2020 Easy