NEET · Biology · STD 12 - 13. biodiversity and conservation
List of endangered species was released by
- A \(WWF\)
- B \(FOAM\)
- C \(IUCN\)
- D \(GEAC\)
Answer & Solution
Correct Answer
(C) \(IUCN\)
Step-by-step Solution
Detailed explanation
List of endangered species was released by - \(IUCN\).
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Life cycles of Ectocarpus and Fucus respectively areNEET 2017 Medium
- In a cross between a male and female, both heterozygous for sickle cell anaemia gene, what percentage of the progeny will be diseased? (In \(\%\))NEET 2021 Medium
- All the components of the nodal tissue are autoexcitable. Why does the SA node act as the normal pacemakar?NEET 2019 Easy
- Match List I with List II :
List I List II A. Productivity I. Gross primary productivity minus respiration losses B. Net primary productivity II. Rate of formation of new organic matter by consumers C. Gross primary productivity III. Rate of biomass production D. Secondary productivity IV. Rate of production of organic matter during photosynthesis NEET 2026 Easy - Veneral diseases can spread through: \((a)\) Using sterile needles \((b)\) Transfusion of blood from infected person \((c)\) Infected mother to foetus \((d)\) Kissing \((e)\) Inheritance Choose the correct answer from the options given below.NEET 2021 Medium
- Drug called Heroin' is synthesized byNEET 2019 Medium
More PYQs from NEET
- A series LCR circuit with inductance \(10\,H\), capacitance \(10\,\mu F\), resistance \(50\,\Omega\) is connected to an ac source of voltage, \(V=200 \sin (100 t)\) volt. If the resonant frequency of the LCR circuit is \(\nu_{0}\) and the frequency of the ac source is \(v\), then:NEET 2022 Medium
- Which of the following statements about cork cambium is incorrect?NEET 2020 Easy
- Which one of the following arrangements represents the correct order of least negative to most negative electron gain enthalpy for \(C, Ca, Al, F\) and \(O\) ?NEET 2013 Hard
- When a block of mass \(M\) is suspended by a long wire of length \(L\), the length of the wire become \((L+l) .\) The elastic potential energy stoped in the extended wire is :NEET 2019 Easy
- In a marriage between male with blood group \(A\) and female with blood group \(B\), the progeny had either blood group \(AB\) or \(B\). What could be the possible genotype of parents ?NEET 2019 Medium
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium