NEET · Biology · STD 12 - 1. sexual reproduction in flowering plants
Identify the correct description about the given figure:
- A Water pollinated flowers showing stamens with mucilaginous covering.
- B Cleistogamous flowers showing autogamy.
- C Compact inflorescence showing complete autogamy
- D Wind pollinated plant inflorescence showing flowers with well exposed stamens.
Answer & Solution
Correct Answer
(D) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
Step-by-step Solution
Detailed explanation
The given diagram shows a wind pollinated plant showing compact inflorescence and well exposed stamens. Stamens are exposed so complete autogamy does not occur.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Which one is the correct product of \(DNA\) dependent \(RNA\) polymerase to the given template? \(3\)'\(TACATGGCAAATATCCATTCA5'\)NEET 2024 Medium
- Match List I with List II :
List I List II A. Incomplete dominance I. Human skin colour B. Co-dominance II. Inheritance of flower colour in Antirrhinumsp. C. Pleiotropy III. Phenylketonuria disease in humans D. Polygenic inheritance IV. ABO blood groups NEET 2026 Easy - Identify the microorganism which is responsible for the production of an immunosuppressive molecule cyclosporin \(A:\)NEET 2022 Easy
- Which of the following statements are correct? \(A\). Basophils are most abundant cells of the total WBCs \(B\). Basophils secrete histamine, serotonin and heparin \(C\). Basophils are involved in inflammatory response \(D\). Basophils have kidney shaped nudeus \(E\). Basophils are agranulocytes Choose the correct answer from the options given below:NEET 2023 Medium
- How many \(ATP\) and \(NADPH _2\) are required for the synthesis of one molecule of Glucose during Calvin cycle?NEET 2023 Medium
- Select the incorrect statements from the following :
A. Digestive system in Platyhelminthes is incomplete.
B. Bilateral symmetry is a characteristic feature of adult Echinoderms.
C. Pseudocoelom is possessed by Aschelminthes.
D. Notochord is persistent throughout life in the class Chondrichthyes.
E. Members of class Reptilia maintain a constant body temperature.
Choose the answer from the options given below :NEET 2026 Medium
More PYQs from NEET
- In which one of the following, the ovules are not enclosed by an ovary wall and remain exposed ?NEET 2026 Hard
- The number of substrate level phosphorylations in one turn of citric acid cycle isNEET 2020 Medium
- Which one of these animals is not a homeotherm?NEET 2018 Medium
- Select the correct option.Direction of Direction of reading of \(RNA\) synthesis the template \(DNA\) strand
Direction of \(RNA\) synthesis Direction of reading of the template \(DNA\) \((a)\) \(5'-3'\) \(3'-5'\) \((b)\) \(3'-5'\) \(5'-3'\) \((c)\) \(5'-3'\) \(5'-3'\) \((d)\) \(3'-5'\) \(3'-5'\) NEET 2014 Medium - In the structure of \(ClF_3\), the number of lone pairs of electrons on central atom \(Cl\) isNEET 2018 Medium
- The radius of Martian orbit around the Sun is about 4 times the radius of the orbit of Mercury. The Martian year is 687 Earth days. Then which of the following is the length of 1 year on Mercury?NEET 2025 Hard