NEET · Biology · STD 11 - 10. Cell cycle and cell division
Crossing over takes place between which chromatids and in which stage of the cell cycle ?
- A Non-sister chromatids of non-homologous chromosomes at Zygotene stage of prophase \(I.\)
- B Non-sister chromatids of homologous chromosomes at Pachytene stage of prophase \(I.\)
- C Non-sister chromatids of homologous chromosomes at Zygotene stage of prophase \(I.\)
- D Non-sister chromatids of non-homologous chromosomes at Pachytene stage of prophase \(I.\)
Answer & Solution
Correct Answer
(B) Non-sister chromatids of homologous chromosomes at Pachytene stage of prophase \(I.\)
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Which one of these animals is not a homeotherm?NEET 2018 Medium
- Which one of the following statements about Histones is wrong?NEET 2021 Medium
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?NEET 2024 Medium
- \(MALT\) constitutes about _______ percent of the lymphoid tissue in human body.NEET 2017 Medium
- The following graph depicts changes in two populations \((A\) and \(B)\) of herbivores in a grassy field. \(A\) possible reason for these changes is that
NEET 2015 Medium
More PYQs from NEET
- The work done to raise a mass \(\mathrm{m}\) from the surface of the earth to a height \(\mathrm{h}\), which is equal to the radius of the earth, isNEET 2019 Medium
- In a potentiometer circuit a cell of \(EMF\) \(1.5\, {V}\) gives balance point at \(36\, {cm}\) length of wire. If another cell of \(EMF\) \(2.5\, {V}\) replaces the first cell, then at what length of the wire, the balance point occurs ? (in \(cm\))NEET 2021 Medium
- Which of following organisms cannot fix nitrogen?
A. Azotobacter
B. Oscillatoria
C. Anabaena
D. Volvox
E. Nostoc
Choose the correct answer from the options given below:NEET 2025 Easy - A stage in cell division is shown in the figure. Select the answer which gives correct identi fication of the stage with its characteristics.
NEET 2013 Medium - A light rod of length \(l\) has two masses \(m_1\) and \(m_2\) attached to its two ends. The moment of inertia of the system about an axis perpendicular to the rod and passing through the centre of mass isNEET 2016 Medium
- Given below are two statements:
Statement \(I\): Chromosomes become gradually visible under light microscope during leptotene stage.
Statement \(II\) : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:NEET 2024 Medium