Concanavalin \(\mathrm{A}\) is

A an alkaloid
B an essential oil
C a lectin
D a pigment

Verified Solution

Answer & Solution

Correct Answer

(C) a lectin

Step-by-step Solution

Detailed explanation

Apply the relevant identity from the chapter and substitute the values established in the previous step, keeping the original constraint in view.

Use the simplified expression to isolate the unknown, then plug the result back into the question setup to confirm the working is internally consistent.

Cross-check against a boundary or limiting case. Both the dimensional balance and the qualitative behaviour at the extreme should agree with the candidate answer.

Combine the steps above to identify the correct option. The remaining choices each fail at least one of the consistency, dimensional, or boundary checks.

Same subject

Choose the wrong statement.

NEET 2015 Medium
A plant in your garden avoids photorespiratory losses, has improved water use efficiency, shows high rates of photosynthesis at high temperatures and has improved efficiency of nitrogen utilisation. In which of the following physiological groups would you assign this plant ?

NEET 2016 Medium
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?

NEET 2023 Medium
Five kingdom system of classification suggested by R.H. Whittaker is not based on

NEET 2014 Medium
When the margins of sepals or petals overlap one another without any particular direction, the condition is termed as

NEET 2014 Medium
Which of the following contraceptive methods do involve a role of hormone?

NEET 2019 Easy

Explore more questions on app

From NEET

Seed formation without fertilisation in flowering plants involves the process of

NEET 2016 Medium
The calculated 'spin-only' magnetic moment of \(Ti ^{2+}\left(3 d^2\right)\) is :

NEET 2026 Hard
The toxin proteins, isolated from Bacillus thuringiensis, coded by which of the following genes would control cotton bollworms and corn borer, respectively ?

NEET 2026 Medium
\(Sc\, (Z = 21)\) is a transition element but \(Zn\, (Z = 30)\) is not because

NEET 2013 Medium
For Young's double slit experiment, two statements are given below : Statement \(I:\) If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement \(II:\) If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below :

NEET 2023 Medium
The anion of acetylacetone \((acac)\) forms \(Co\, (acac)_3\) chelate with \(Co^{3+}.\) The rings of the chelate are

NEET 2013 Medium

Explore more questions on app