NEET · Biology · STD 12 - 11. organisms and populations
Carnivorous animals - lions and leopards, occupy the same niche but lions predate mostly larger animals and leopards take smaller ones. This mechanism of competition is referred to as
- A Character displacement
- B Altruism
- C Resource partitioning
- D Competitive exclusion
Answer & Solution
Correct Answer
(C) Resource partitioning
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- One of the legal methods of birth control isNEET 2013 Medium
- Which of the following pair of organelles does not contaln \(DNA\)?NEET 2019 Easy
- A biologist studied the population of rats in a barn. He found that the average natality was \(250\), average mortality \(240\), immigration \(20\) and emigration \(30\). The net increase in population isNEET 2013 Medium
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- Tubectomy is a method of sterilization in whichNEET 2014 Medium
- How many different proteins does the ribosome consist of?NEET 2023 Medium
More PYQs from NEET
- Cotyledon of maize grain is calledNEET 2016 Medium
- Given below are two statements : Statement \(I:\)The coagulum is formed of network of threads called thrombins. Statement \(II :\)Spleen is the graveyard of erythrocytes. In the light of the above statements, choose the most appropriate answer from the options given below:NEET 2022 Medium
- Given below are two statements: One is labelled as Assertion \((A)\) and the other is labelled as Reason \((R)\). Assertion \((A)\):The stretching of a spring is determined by the shear modulus of the material of the spring. Reason \((R)\):A coil spring of copper has more tensile strength than a steel spring of same dimensions. In the light of the above statements, choose the most appropriate answer from the options given below:NEET 2022 Medium
- Which structures perform the function of mitochondria in bacteria?NEET 2014 Medium
- A stage of mitosis is shown in the diagram. Which stage is it and what are its characteristics?
NEET 2013 Easy - If for a certain reaction \(\Delta_{r} H\) is \(30 \;kJ \;mol ^{-1}\) at \(450 \;K ,\) the value of \(\Delta_{r} S \left(\right.\) in \(\left. J K ^{-1} mol ^{-1}\right)\) for which the same reaction will be spontaneous at the same temperature isNEET 2020 Medium