NEET · Biology · STD 11 - 5. Morphology flowering plants
Axile placentation is present in
- A pea
- B Argemone
- C Dianthus
- D lemon
Answer & Solution
Correct Answer
(D) lemon
Step-by-step Solution
Detailed explanation
(d) : Axile placentation occurs in syncarpous pistils. The ovary is partitioned into two or more chambers. Placentae occur in the central region where the septa meet so that an axile column bearing ovules is formed \(e.g.\), shoe flower (pentalocular), lemon (multilocular), etc.
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Given below are two statements: Statement \(I\) : Bt toxins are insect group specific and coded by a gene cry \(IAc\). Statement \(II\) : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic \(\mathrm{pH}\) of the insect gut. In the light of the above statements, choose the correct answer from the options given below:NEET 2024 Medium
- The term 'Nuclein' for the genetic material was used byNEET 2020 Easy
- Consider the following statements :
\(A\). Annelids are true coelomates
\(B\). Poriferans are pseudocoelomates
\(C\). Aschelminthes are acoelomates
\(D\). Platyhelminthes are pseudocoelomates.
Choose the correct answer from the options given below :NEET 2024 Medium - In photosynthesis, the lightindependent reactions take place atNEET 2015 Medium
- Fertilisation in humans is practically feasible only ifNEET 2016 Medium
- Which of the following statements about enzymes is wrong ?NEET 2013 Medium
More PYQs from NEET
- In a test cross involving \(F_1\) dihybrid flies, more parentaltype offspring were produced than the recombinanttype offspring. This indicatesNEET 2016 Medium
- Which of the following statements is incorrect?NEET 2021 Medium
- Number of isomeric alcohols of molecular formula \(C_6H_{14}O\) which give positive iodoform test isNEET 2013 Hard
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- Consider the following statements regarding function of adrenal medullary hormones :
(A) It causes pupilary constriction.
(B) It is a hyperglycemic hormone.
(C) It causes piloerection.
(D) It increases strength of heart contraction.
Choose the correct answer from the options given below :NEET 2025 Medium - Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?NEET 2024 Medium