NEET · Biology · STD 12 - 13. biodiversity and conservation
All of the following are included in ‘Ex-situconservation’ except
- A Sacred groves
- B Wildlife safari parks
- C Botanical gardens
- D Seed banks
Answer & Solution
Correct Answer
(A) Sacred groves
Step-by-step Solution
Detailed explanation
See the Complete Solution
Get step-by-step explanations for this and 2.5 Lakh+ more JEE, NEET & CET questions.
- Unlock all solutions
- Practice the full chapter
- Track accuracy across PYQs
4.8 rated on Google Play · 14,000+ reviews
More questions from Biology
- Match the following:
Choose the correct answer from the options given below.List \(- I\) List \(-II\) (a) Physalia (i) Pearl oyster (b) Limulus (ii) Portuguese Man of War (c) Ancylostoma (iii) Living fossil (d) Pinctada (iv) Hookworm NEET 2021 Medium - Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows \(5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'\)?NEET 2023 Medium
- In case of a couple where the male is having a very low sperm count, which technique will be suitable for fertilisation?NEET 2017 Medium
- Among flowers of Calotropis, tulip, Sesbania, Asparagus, Colchicum, sweet pea, Petunia, Indigofera, mustard, soybean, tobacco and groundnut, how many plants have corolla with valvate aestivation?NEET 2013 Medium
- The two antibiotic resistance genes on vector \(pBR322\) are forNEET 2019 Easy
- What is the name of the blood vessel that carries deoxygenated blood from the body to the heart in a frog?NEET 2025 Easy
More PYQs from NEET
- Phenolphthalein is used as an indicator for the titration of sodium hydroxide solution against a standard solution of oxalic acid. The colour change that is observed at an alkaline pH close to the equivalence point during this titration is :NEET 2026 Hard
- \((I)\,\, H_2O_2 + O_3 \rightarrow H_2O + 2O_2\) \((II)\,\, H_2O_2 + Ag_2O \rightarrow 2Ag + H_2O + O_2\) Role of hydrogen peroxide in the above reactions is respectivelyNEET 2014 Medium
- The Crystal Field Stablilisation Energy \((CFSE)\) for \(\left[\mathrm{CoCl}_{6}\right]^{4-}\) is \(18000 \;\mathrm{cm}^{-1}\). The \(CFSE\) for \(\left[\mathrm{CoCl}_{4}\right]^{2-}\) will be ......\({cm}^{-1}\)NEET 2019 Hard
- Which of the following is paramagnetic ?NEET 2019 Medium
- Identify the incorrect pair.NEET 2021 Medium
- Which of the following options represents the correct bond order?NEET 2015 Medium